METABOLISM OF PURINE & PYRIMIDINE NUCLEOTIDES / 301
β-Alanine
β-Ureidopropionate
(
N
-carbamoyl-β-alanine)
-Aminoisobutyrate
β
C
O
N
H
CH
2
C
H
CH
3
COO
H
2
N
H
2
O
β-Ureidoisobutyrate
(
N
-carbamoyl-β-amino-
isobutyrate)
Dihydrothymine
N
H
H
H
H
CH
3
O
O
HN
Thymine
C
O
N
H
CH
2
CH
2
COO
H
2
N
N
H
O
O
HN
CH
3
Dihydrouracil
N
H
H
H
H
H
O
O
HN
NADP
+
NADPH + H
+
Uracil
N
H
O
O
HN
O
2
NH
H
2
O
3
Cytosine
N
H
O
N
NH
2
CH
3
H
3
N
+
CH
2
CH
COO
COO
H
3
N
+
CH
2
CH
2
+ NH
3
CO
2
1
/2
Figure 34–9.
Catabolism of pyrimidines.
Excess carbamoyl phosphate exits to the cytosol, where
it stimulates pyrimidine nucleotide biosynthesis. The
resulting mild orotic aciduria is increased by high-
nitrogen foods.
Drugs May Precipitate Orotic Aciduria
Allopurinol (Figure 33–12), an alternative substrate for
orotate phosphoribosyltransferase (reaction 5, Figure
34–7), competes with orotic acid. The resulting nu-
cleotide product also inhibits orotidylate decarboxylase
(reaction 6, Figure 34–7), resulting in orotic aciduria
and orotidinuria. 6-Azauridine, following conversion
to 6-azauridylate, also competitively inhibits orotidylate
decarboxylase (reaction 6, Figure 34–7), enhancing ex-
cretion of orotic acid and orotidine.
SUMMARY
• Ingested nucleic acids are degraded to purines and
pyrimidines. New purines and pyrimidines are
formed from amphibolic intermediates and thus are
dietarily nonessential.
• Several reactions of IMP biosynthesis require folate
derivatives and glutamine. Consequently, antifolate
drugs and glutamine analogs inhibit purine biosyn-
thesis.
• Oxidation and amination of IMP forms AMP and
GMP, and subsequent phosphoryl transfer from
ATP forms ADP and GDP. Further phosphoryl
transfer from ATP to GDP forms GTP. ADP is con-
verted to ATP by oxidative phosphorylation. Reduc-
tion of NDPs forms dNDPs.
• Hepatic purine nucleotide biosynthesis is stringently
regulated by the pool size of PRPP and by feedback
inhibition of PRPP-glutamyl amidotransferase by
AMP and GMP.
• Coordinated regulation of purine and pyrimidine
nucleotide biosynthesis ensures their presence in pro-
portions appropriate for nucleic acid biosynthesis
and other metabolic needs.
• Humans catabolize purines to uric acid (pK
a
5.8),
present as the relatively insoluble acid at acidic pH or
as its more soluble sodium urate salt at a pH near
neutrality. Urate crystals are diagnostic of gout.
Other disorders of purine catabolism include Lesch-
Nyhan syndrome, von Gierke’s disease, and hypo-
uricemias.
• Since pyrimidine catabolites are water-soluble, their
overproduction does not result in clinical abnormali-
ties. Excretion of pyrimidine precursors can, how-
ever, result from a deficiency of ornithine transcar-
bamoylase because excess carbamoyl phosphate is
available for pyrimidine biosynthesis.
Convert .pdf to .jpg online - Convert PDF to JPEG images in C#.net, ASP.NET MVC, WinForms, WPF project
How to convert PDF to JPEG using C#.NET PDF to JPEG conversion / converter library control SDK
convert pdf to 300 dpi jpg; .net pdf to jpg
Convert .pdf to .jpg online - VB.NET PDF Convert to Jpeg SDK: Convert PDF to JPEG images in vb.net, ASP.NET MVC, WinForms, WPF project
Online Tutorial for PDF to JPEG (JPG) Conversion in VB.NET Image Application
convert pdf page to jpg; convert pdf to jpg file
302 / CHAPTER 34
REFERENCES
Benkovic SJ: The transformylase enzymes in de novo purine
biosynthesis. Trends Biochem Sci 1994;9:320.
Brooks EM et al: Molecular description of three macro-deletions
and an Alu-Alu recombination-mediated duplication in the
HPRT gene in four patients with Lesch-Nyhan disease.
Mutat Res 2001;476:43.
Curto R, Voit EO, Cascante M: Analysis of abnormalities in purine
metabolism leading to gout and to neurological dysfunctions
in man. Biochem J 1998;329:477.
Harris MD, Siegel LB, Alloway JA: Gout and hyperuricemia. Am
Family Physician 1999;59:925.
Lipkowitz MS et al: Functional reconstitution, membrane target-
ing, genomic structure, and chromosomal localization of a
human urate transporter. J Clin Invest 2001;107:1103.
Martinez J et al: Human genetic disorders, a phylogenetic perspec-
tive. J Mol Biol 2001;308:587.
Puig JG et al: Gout: new questions for an ancient disease. Adv Exp
Med Biol 1998;431:1.
Scriver CR et al (editors): The Metabolic and Molecular Bases of In-
herited Disease,8th ed. McGraw-Hill, 2001.
Tvrdik T et al: Molecular characterization of two deletion events
involving Alu-sequences, one novel base substitution and two
tentative hotspot mutations in the hypoxanthine phosphori-
bosyltransferase gene in five patients with Lesch-Nyhan-
syndrome. Hum Genet 1998;103:311.
Zalkin H, Dixon JE: De novo purine nucleotide synthesis. Prog
Nucleic Acid Res Mol Biol 1992;42:259.
Online Convert Jpeg to PDF file. Best free online export Jpg image
Online JPEG to PDF Converter. Download Free Trial. Convert a JPG to PDF. You can drag and drop your JPG file in the box, and then start
convert pdf to jpg for online; convert .pdf to .jpg online
Online Convert PDF to Jpeg images. Best free online PDF JPEG
Online PDF to JPEG Converter. Download Free Trial. Convert a PDF File to JPG. Drag and drop your PDF in the box above and we'll convert the files for you.
best way to convert pdf to jpg; change pdf to jpg
Nucleic Acid Structure & Function
35
303
Daryl K. Granner, MD
BIOMEDICAL IMPORTANCE
The discovery that genetic information is coded along
the length of a polymeric molecule composed of only
four types of monomeric units was one of the major sci-
entific achievements of the twentieth century. This
polymeric molecule, DNA, is the chemical basis of
heredity and is organized into genes, the fundamental
units of genetic information. The basic information
pathway—ie, DNA directs the synthesis of RNA,
which in turn directs protein synthesis—has been eluci-
dated. Genes do not function autonomously; their
replication and function are controlled by various gene
products, often in collaboration with components of
various signal transduction pathways. Knowledge of the
structure and function of nucleic acids is essential in
understanding genetics and many aspects of pathophys-
iology as well as the genetic basis of disease.
DNA CONTAINS THE 
GENETIC INFORMATION
The demonstration that DNA contained the genetic in-
formation was first made in 1944 in a series of experi-
ments by Avery, MacLeod, and McCarty. They showed
that the genetic determination of the character (type) of
the capsule of a specific pneumococcus could be trans-
mitted to another of a different capsular type by intro-
ducing purified DNA from the former coccus into the
latter. These authors referred to the agent (later shown
to be DNA) accomplishing the change as “transforming
factor.” Subsequently, this type of genetic manipulation
has become commonplace. Similar experiments have
recently been performed utilizing yeast, cultured mam-
malian cells, and insect and mammalian embryos as re-
cipients and cloned DNA as the donor of genetic infor-
mation.
DNA Contains Four Deoxynucleotides
The chemical nature of the monomeric deoxynucleo-
tide units of DNA—deoxyadenylate, deoxyguanylate,
deoxycytidylate, and thymidylate—is described in
Chapter 33. These monomeric units of DNA are held
in polymeric form by 3′,5′-phosphodiester bridges con-
stituting a single strand, as depicted in Figure 35–1.
The informational content of DNA (the genetic code)
resides in the sequence in which these monomers—
purine and pyrimidine deoxyribonucleotides—are or-
dered. The polymer as depicted possesses a polarity;
one end has a 5′-hydroxyl or phosphate terminal while
the other has a 3′-phosphate or hydroxyl terminal. The
importance of this polarity will become evident. Since
the genetic information resides in the order of the
monomeric units within the polymers, there must exist
a mechanism of reproducing or replicating this specific
information with a high degree of fidelity. That re-
quirement, together with x-ray diffraction data from
the DNA molecule and the observation of Chargaff
that in DNA molecules the concentration of de-
oxyadenosine (A) nucleotides equals that of thymidine
(T) nucleotides (A = T), while the concentration of de-
oxyguanosine (G) nucleotides equals that of deoxycyti-
dine (C) nucleotides (G = C), led Watson, Crick, and
Wilkins to propose in the early 1950s a model of a dou-
ble-stranded DNA molecule. The model they proposed
is depicted in Figure 35–2. The two strands of this
double-stranded helix are held in register by hydrogen
bondsbetween the purine and pyrimidine bases of the
respective linear molecules. The pairings between the
purine and pyrimidine nucleotides on the opposite
strands are very specific and are dependent upon hydro-
gen bonding of A with Tand G with C(Figure 35–3).
This common form of DNA is said to be right-
handed because as one looks down the double helix the
base residues form a spiral in a clockwise direction. In
the double-stranded molecule, restrictions imposed by
the rotation about the phosphodiester bond, the fa-
vored anti configuration of the glycosidic bond (Figure
33–8), and the predominant tautomers (see Figure
33–3) of the four bases (A, G, T, and C) allow A to pair
only with T and G only with C, as depicted in Figure
35–3. This base-pairing restriction explains the earlier
observation that in a double-stranded DNA molecule
the content of A equals that of T and the content of G
equals that of C. The two strands of the double-helical
molecule, each of which possesses a polarity, are an-
tiparallel;ie, one strand runs in the 5′to 3′direction
and the other in the 3′to 5′direction. This is analogous
to two parallel streets, each running one way but carry-
ing traffic in opposite directions. In the double-
stranded DNA molecules, the genetic information re-
C# Image Convert: How to Convert Adobe PDF to Jpeg, Png, Bmp, &
This demo code just converts first page to jpeg image. String inputFilePath = @"C:\input.pdf"; String outputFilePath = @"C:\output.jpg"; // Convert PDF to jpg.
convert .pdf to .jpg; best convert pdf to jpg
C# Image Convert: How to Convert Tiff Image to Jpeg, Png, Bmp, &
RasterEdge.XDoc.PDF.dll. This demo code will convert first page to jpeg image. C:\input.tif"; String outputFilePath = @"C:\output.jpg"; // Convert tiff to jpg.
change pdf to jpg format; .net convert pdf to jpg
304 / CHAPTER 35
O
H
H
H
H
N
N
N
NH
G
NH
2
O
H
CH
2
O
H
H
N
O
N
C
NH
2
H
H
CH
2
H
O
H
H
H
H
H
N
O
O
NH
H
3
C
T
CH
2
CH
2
O
H
H
H
H
H
NH
2
N
N
N
N
A
5
3
O
O
P
O
P
O
P
O
O
P
O
O
P
Figure 35–1.
A segment of one strand of a DNA molecule in which the purine and pyrimidine bases guanine
(G), cytosine (C), thymine (T), and adenine (A) are held together by a phosphodiester backbone between 2′-de-
oxyribosyl moieties attached to the nucleobases by an N-glycosidic bond. Note that the backbone has a polarity
(ie, a direction). Convention dictates that a single-stranded DNA sequence is written in the 5′to 3′direction (ie,
pGpCpTpA, where G, C, T, and A represent the four bases and p represents the interconnecting phosphates).
sides in the sequence of nucleotides on one strand, the
template strand. This is the strand of DNA that is
copied during nucleic acid synthesis. It is sometimes re-
ferred to as the noncoding strand.The opposite strand
is considered the coding strandbecause it matches the
RNA transcript that encodes the protein.
The two strands, in which opposing bases are held
together by hydrogen bonds, wind around a central axis
in the form of a double helix.Double-stranded DNA
exists in at least six forms (A–E and Z). The B form is
usually found under physiologic conditions (low salt,
high degree of hydration). A single turn of B-DNA
about the axis of the molecule contains ten base pairs.
The distance spanned by one turn of B-DNA is 3.4
nm. The width (helical diameter) of the double helix in
B-DNA is 2 nm.
As depicted in Figure 35–3, three hydrogen bonds
hold the deoxyguanosine nucleotide to the deoxycyti-
dine nucleotide, whereas the other pair, the A–T pair, is
held together by two hydrogen bonds. Thus, the G–C
bonds are much more resistant to denaturation, or
“melting,” than A–T-rich regions.
The Denaturation (Melting) of DNA 
Is Used to Analyze Its Structure
The double-stranded structure of DNA can be sepa-
rated into two component strands (melted) in solution
by increasing the temperature or decreasing the salt
concentration. Not only do the two stacks of bases pull
apart but the bases themselves unstack while still con-
nected in the polymer by the phosphodiester backbone.
Concomitant with this denaturation of the DNA mole-
cule is an increase in the optical absorbance of the
purine and pyrimidine bases—a phenomenon referred
to as hyperchromicityof denaturation. Because of the
C# Create PDF from images Library to convert Jpeg, png images to
Batch convert PDF documents from multiple image formats, including Jpg, Png, Bmp, Gif, Tiff, Bitmap, .NET Graphics, and REImage.
convert pdf images to jpg; convert pdf to jpg 300 dpi
VB.NET PDF Convert to Images SDK: Convert PDF to png, gif images
Resize converted image files in VB.NET. Convert PDF to Jpg, Png, Bmp, Gif, Tiff and Bitmap in ASP.NET. Embed PDF to image converter in viewer.
convert multiple pdf to jpg online; change file from pdf to jpg on
NUCLEIC ACID STRUCTURE & FUNCTION / 305
S
A
T
S
S
S
T
A
P
P
P
P
P
P
S
G
C
S
S
G
C
S
Minor groove
34 A
20 A
Major groove
o
o
Figure 35–2.
A diagrammatic representation of the
Watson and Crick model of the double-helical structure
of the B form of DNA. The horizontal arrow indicates
the width of the double helix (20 Å), and the vertical
arrow indicates the distance spanned by one complete
turn of the double helix (34 Å). One turn of B-DNA in-
cludes ten base pairs (bp), so the rise is 3.4 Å per bp.
The central axis of the double helix is indicated by the
vertical rod. The short arrows designate the polarity of
the antiparallel strands. The major and minor grooves
are depicted. (A, adenine; C, cytosine; G, guanine;
T,thymine; P, phosphate; S, sugar [deoxyribose].)
N
N
N
N
N
N
O
N
N
O
O
CH
3
O
H
H
H
H
H
N
N
H
H
Thymidine
Adenosine
Guanosine
Cytosine
H
N
N
N
N
N
Figure 35–3.
Base pairing between deoxyadenosine
and thymidine involves the formation of two hydrogen
bonds. Three such bonds form between deoxycytidine
and deoxyguanosine. The broken lines represent hy-
drogen bonds.
stacking of the bases and the hydrogen bonding be-
tween the stacks, the double-stranded DNA molecule
exhibits properties of a rigid rod and in solution is a vis-
cous material that loses its viscosity upon denaturation.
The strands of a given molecule of DNA separate
over a temperature range. The midpoint is called the
melting temperature, or T
m
. The T
m
is influenced by
the base composition of the DNA and by the salt con-
centration of the solution. DNA rich in G–C pairs,
which have three hydrogen bonds, melts at a higher tem-
perature than that rich in A–T pairs, which have two hy-
drogen bonds. A tenfold increase of monovalent cation
concentration increases the T
m
by 16.6 °C. Formamide,
which is commonly used in recombinant DNA experi-
ments, destabilizes hydrogen bonding between bases,
thereby lowering the T
m
. This allows the strands of DNA
or DNA-RNA hybrids to be separated at much lower
temperatures and minimizes the phosphodiester bond
breakage that occurs at high temperatures.
Renaturation of DNA Requires 
Base Pair Matching
Separated strands of DNA will renature or reassociate
when appropriate physiologic temperature and salt con-
ditions are achieved. The rate of reassociation depends
upon the concentration of the complementary strands.
Reassociation of the two complementary DNA strands
of a chromosome after DNA replication is a physiologic
example of renaturation (see below). At a given temper-
ature and salt concentration, a particular nucleic acid
strand will associate tightly only with a complementary
strand. Hybrid molecules will also form under appro-
priate conditions. For example, DNA will form a hy-
brid with a complementary DNA (cDNA) or with a
cognate messenger RNA (mRNA; see below). When
combined with gel electrophoresis techniques that sepa-
rate hybrid molecules by size and radioactive labeling to
provide a detectable signal, the resulting analytic tech-
niques are called Southern (DNA/cDNA)and North-
ern blotting (DNA/RNA),respectively. These proce-
VB.NET PDF - Convert PDF with VB.NET WPF PDF Viewer
Jpeg, VB.NET compress PDF, VB.NET print PDF, VB.NET merge PDF files, VB.NET view PDF online, VB.NET Convert PDF to image formats, such as PNG, JPG, BMP and
changing pdf to jpg; convert pdf pictures to jpg
VB.NET Create PDF from images Library to convert Jpeg, png images
Components to batch convert PDF documents in Visual Basic .NET class. Support create PDF from multiple image formats in VB.NET, including Jpg, Png, Bmp, Gif
batch pdf to jpg converter online; .pdf to jpg converter online
306 / CHAPTER 35
dures allow for very specific identification of hybrids
from mixtures of DNA or RNA (see Chapter 40).
There Are Grooves in the DNA Molecule
Careful examination of the model depicted in Figure
35–2 reveals a major grooveand a minor groovewind-
ing along the molecule parallel to the phosphodiester
backbones. In these grooves, proteins can interact specif-
ically with exposed atoms of the nucleotides (usually by
H bonding) and thereby recognize and bind to specific
nucleotide sequences without disrupting the base pair-
ing of the double-helical DNA molecule. As discussed in
Chapters 37 and 39, regulatory proteins control the ex-
pression of specific genes via such interactions.
DNA Exists in Relaxed 
& Supercoiled Forms
In some organisms such as bacteria, bacteriophages, and
many DNA-containing animal viruses, the ends of the
DNA molecules are joined to create a closed circle with
no covalently free ends. This of course does not destroy
the polarity of the molecules, but it eliminates all free 3′
and 5′hydroxyl and phosphoryl groups. Closed circles
exist in relaxed or supercoiled forms. Supercoils are intro-
duced when a closed circle is twisted around its own axis
or when a linear piece of duplex DNA, whose ends are
fixed, is twisted. This energy-requiring process puts the
molecule under stress, and the greater the number of su-
percoils, the greater the stress or torsion (test this by
twisting a rubber band). Negative supercoilsare formed
when the molecule is twisted in the direction opposite
from the clockwise turns of the right-handed double
helix found in B-DNA. Such DNA is said to be under-
wound. The energy required to achieve this state is, in a
sense, stored in the supercoils. The transition to another
form that requires energy is thereby facilitated by the un-
derwinding. One such transition is strand separation,
which is a prerequisite for DNA replication and tran-
scription. Supercoiled DNA is therefore a preferred form
in biologic systems. Enzymes that catalyze topologic
changes of DNA are called topoisomerases.Topoisom-
erases can relax or insert supercoils. The best-character-
ized example is bacterial gyrase,which induces negative
supercoiling in DNA using ATP as energy source. Ho-
mologs of this enzyme exist in all organisms and are im-
portant targets for cancer chemotherapy.
DNA PROVIDES A TEMPLATE FOR
REPLICATION & TRANSCRIPTION
The genetic information stored in the nucleotide se-
quence of DNA serves two purposes. It is the source of
information for the synthesis of all protein molecules of
the cell and organism, and it provides the information
inherited by daughter cells or offspring. Both of these
functions require that the DNA molecule serve as a
template—in the first case for the transcription of the
information into RNA and in the second case for the
replication of the information into daughter DNA mol-
ecules.
The complementarity of the Watson and Crick dou-
ble-stranded model of DNA strongly suggests that
replication of the DNA molecule occurs in a semicon-
servative manner. Thus, when each strand of the dou-
ble-stranded parental DNA molecule separates from its
complement during replication, each serves as a tem-
plate on which a new complementary strand is synthe-
sized (Figure 35–4). The two newly formed double-
stranded daughter DNA molecules, each containing
one strand (but complementary rather than identical)
from the parent double-stranded DNA molecule, are
then sorted between the two daughter cells (Figure
35–5). Each daughter cell contains DNA molecules
with information identical to that which the parent
possessed; yet in each daughter cell the DNA molecule
of the parent cell has been only semiconserved.
THE CHEMICAL NATURE OF RNA DIFFERS
FROM THAT OF DNA
Ribonucleic acid (RNA) is a polymer of purine and
pyrimidine ribonucleotides linked together by 3′,5′-
phosphodiester bridges analogous to those in DNA
(Figure 35–6). Although sharing many features with
DNA, RNA possesses several specific differences:
(1) In RNA, the sugar moiety to which the phos-
phates and purine and pyrimidine bases are attached is
ribose rather than the 2′-deoxyribose of DNA.
(2)The pyrimidine components of RNA differ from
those of DNA. Although RNA contains the ribonu-
cleotides of adenine, guanine, and cytosine, it does not
possess thymine except in the rare case mentioned
below. Instead of thymine, RNA contains the ribonu-
cleotide of uracil.
(3)RNA exists as a single strand, whereas DNA ex-
ists as a double-stranded helical molecule. However,
given the proper complementary base sequence with
opposite polarity, the single strand of RNA—as
demonstrated in Figure 35–7—is capable of folding
back on itself like a hairpin and thus acquiring double-
stranded characteristics.
(4)Since the RNA molecule is a single strand com-
plementary to only one of the two strands of a gene, its
guanine content does not necessarily equal its cytosine
content, nor does its adenine content necessarily equal
its uracil content.
NUCLEIC ACID STRUCTURE & FUNCTION / 307
G
C
G
C
G
A
T
C
G
C
T
A
C
A
A
T
T
C
C
G
C
G
G
G
C
G
G
A
A
T
C
G
T
A
C
A
C
G
T
A
A
T
T
T
T
A
A
G
G
C
C
A
T
A
T
A
T
A
A
A
T
A
T
A
T
OLD
OLD
5
3
5
3
5
3
5
3
OLD
OLD
NEW
NEW
Figure 35–4.
The double-stranded structure of DNA
and the template function of each old strand (dark
shading) on which a new (light shading) complemen-
tary strand is synthesized. 
Original
parent molecule
First-generation
daughter molecules
Second-generation
daughter molecules
Figure 35–5.
DNA replication is semiconservative.
During a round of replication, each of the two strands
of DNA is used as a template for synthesis of a new,
complementary strand.
complementarity, an RNA molecule can bind specifi-
cally via the base-pairing rules to its template DNA
strand; it will not bind (“hybridize”) with the other
(coding) strand of its gene. The sequence of the RNA
molecule (except for U replacing T) is the same as that
of the coding strand of the gene (Figure 35–8).
Nearly All of the Several Species of RNA
Are Involved in Some Aspect of Protein
Synthesis
Those cytoplasmic RNA molecules that serve as tem-
plates for protein synthesis (ie, that transfer genetic in-
formation from DNA to the protein-synthesizing ma-
chinery) are designated messenger RNAs,or mRNAs.
Many other cytoplasmic RNA molecules (ribosomal
RNAs;rRNAs) have structural roles wherein they con-
(5)RNA can be hydrolyzed by alkali to 2′,3′cyclic
diesters of the mononucleotides, compounds that can-
not be formed from alkali-treated DNA because of the
absence of a 2′-hydroxyl group. The alkali lability of
RNA is useful both diagnostically and analytically.
Information within the single strand of RNA is con-
tained in its sequence (“primary structure”) of purine
and pyrimidine nucleotides within the polymer. The
sequence is complementary to the template strand of
the gene from which it was transcribed. Because of this
308 / CHAPTER 35
O
H
H
HO
H
H
N
O
O
NH
U
CH
2
O
H
HO
H
H
N
N
N
NH
G
NH
2
O
H
CH
2
5
CH
2
O
H
H
HO
H
H
NH
2
N
N
N
N
A
3
O
HO
H
N
O
N
C
NH
2
H
H
CH
2
H
O
O
P
O
O
P
O
O
P
O
P
O
P
Figure 35–6.
A segment of a ribonucleic acid (RNA) molecule in which the purine and pyrimidine bases—
guanine (G), cytosine (C), uracil (U), and adenine (A)—are held together by phosphodiester bonds between ribo-
syl moieties attached to the nucleobases by N-glycosidic bonds. Note that the polymer has a polarity as indi-
cated by the labeled 3′- and 5′-attached phosphates.
tribute to the formation and function of ribosomes (the
organellar machinery for protein synthesis) or serve as
adapter molecules (transfer RNAs; tRNAs) for the
translation of RNA information into specific sequences
of polymerized amino acids.
Some RNA molecules have intrinsic catalytic activ-
ity. The activity of these ribozymesoften involves the
cleavage of a nucleic acid. An example is the role of
RNA in catalyzing the processing of the primary tran-
script of a gene into mature messenger RNA.
Much of the RNA synthesized from DNA templates
in eukaryotic cells, including mammalian cells, is de-
graded within the nucleus, and it never serves as either a
structural or an informational entity within the cellular
cytoplasm.
In all eukaryotic cells there are small nuclear RNA
(snRNA)species that are not directly involved in pro-
tein synthesis but play pivotal roles in RNA processing.
These relatively small molecules vary in size from 90 to
about 300 nucleotides (Table 35–1).
The genetic material for some animal and plant
viruses is RNA rather than DNA. Although some RNA
viruses never have their information transcribed into a
DNA molecule, many animal RNA viruses—specifi-
cally, the retroviruses (the HIV virus, for example)—are
transcribed by an RNA-dependent DNA polymerase,
the so-called reverse transcriptase,to produce a dou-
ble-stranded DNA copy of their RNA genome. In
many cases, the resulting double-stranded DNA tran-
script is integrated into the host genome and subse-
quently serves as a template for gene expression and
from which new viral RNA genomes can be tran-
scribed.
RNA Is Organized in Several 
Unique Structures
In all prokaryotic and eukaryotic organisms, three main
classes of RNA molecules exist: messenger RNA
(mRNA), transfer RNA (tRNA), and ribosomal RNA
NUCLEIC ACID STRUCTURE & FUNCTION / 309
C
G
C
G
G
C
A
U
A
U
A
U
U
G
U
G
C
C
G
C
U
A
U
A
U
C
U
A
C
G
G
C
3
5
Stem
Loop
Figure 35–7.
Diagrammatic representation of the
secondary structure of a single-stranded RNA molecule
in which a stem loop, or “hairpin,” has been formed and
is dependent upon the intramolecular base pairing.
Note that A forms hydrogen bonds with U in RNA.
Table 35–1. Some of the species of small stable
RNAs found in mammalian cells.
Length
Molecules
Name (nucleotides) ) per Cell
Localization
U1
165
1 ×10
6
Nucleoplasm/hnRNA
U2
188
5 ×10
5
Nucleoplasm
U3
216
3 ×105
Nucleolus
U4
139
1 ×10
5
Nucleoplasm
U5
118
2 ×10
5
Nucleoplasm
U6
106
3 ×105
Perichromatin granules
4.5S
91–95
3 x 10
5
Nucleus and cytoplasm
7S
280
5 ×10
5
Nucleus and cytoplasm
7-2
290
1 ×105
Nucleus and cytoplasm
7-3
300
2 ×10
5
Nucleus
(rRNA). Each differs from the others by size, function,
and general stability.
A. M
ESSENGER
RNA (
M
RNA)
This class is the most heterogeneous in size and stabil-
ity. All members of the class function as messengers
conveying the information in a gene to the protein-
synthesizing machinery, where each serves as a template
on which a specific sequence of amino acids is polymer-
ized to form a specific protein molecule, the ultimate
gene product (Figure 35–9).
Messenger RNAs, particularly in eukaryotes, have
some unique chemical characteristics. The 5′terminal
of mRNA is “capped” by a 7-methylguanosine triphos-
phate that is linked to an adjacent 2′-O-methyl ribonu-
cleoside at its 5′-hydroxyl through the three phosphates
(Figure 35–10). The mRNA molecules frequently con-
tain internal 6-methyladenylates and other 2′-O-ribose
methylated nucleotides. The cap is involved in the
recognition of mRNA by the translating machinery,
and it probably helps stabilize the mRNA by preventing
the attack of 5′-exonucleases. The protein-synthesizing
machinery begins translating the mRNA into proteins
beginning downstream of the 5′ or capped terminal.
The other end of most mRNA molecules, the 3′-hy-
droxyl terminal, has an attached polymer of adenylate
residues 20–250 nucleotides in length. The specific
function of the poly(A) “tail”at the 3′-hydroxyl termi-
nal of mRNAs is not fully understood, but it seems that
it maintains the intracellular stability of the specific
mRNA by preventing the attack of 3′-exonucleases.
Some mRNAs, including those for some histones, do
not contain poly(A). The poly(A) tail, because it will
form a base pair with oligodeoxythymidine polymers
attached to a solid substrate like cellulose, can be used
to separate mRNA from other species of RNA, includ-
ing mRNA molecules that lack this tail.
DNA strands:
Coding 
Template 
5′ —
3′ —
— 3
— 5
TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG
ACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTAC
pAUUGUGAGCGGAUAACAAUUUCACACAGGAAACAGCUAUGACCAUG
RNA
transcript
5
3
Figure 35–8.
The relationship between the sequences of an RNA transcript and its gene, in which the cod-
ing and template strands are shown with their polarities. The RNA transcript with a 5′to 3′polarity is comple-
mentary to the template strand with its 3′to 5′polarity. Note that the sequence in the RNA transcript and its
polarity is the same as that in the coding strand, except that the U of the transcript replaces the T of the gene.
310 / CHAPTER 35
Completed
protein
molecule
5
3
5
3
5
3
3
5
DNA
mRNA
Ribosome
Protein synthesis on mRNA template
Figure 35–9.
The expression of genetic in-
formation in DNA into the form of an mRNA
transcript. This is subsequently translated by
ribosomes into a specific protein molecule.
In mammalian cells, including cells of humans, the
mRNA molecules present in the cytoplasm are not the
RNA products immediately synthesized from the DNA
template but must be formed by processing from a pre-
cursor molecule before entering the cytoplasm. Thus,
in mammalian nuclei, the immediate products of gene
transcription constitute a fourth class of RNA mole-
cules. These nuclear RNA molecules are very heteroge-
neous in size and are quite large. The heterogeneous
nuclear RNA (hnRNA)molecules may have a molecu-
lar weight in excess of 107, whereas the molecular
weight of mRNA molecules is generally less than 2 ×
106. As discussed in Chapter 37, hnRNA molecules are
processed to generate the mRNA molecules which then
enter the cytoplasm to serve as templates for protein
synthesis.
B. T
RANSFER
RNA (
T
RNA)
tRNA molecules vary in length from 74 to 95 nu-
cleotides. They also are generated by nuclear processing
of a precursor molecule (Chapter 37). The tRNA mole-
cules serve as adapters for the translation of the infor-
mation in the sequence of nucleotides of the mRNA
into specific amino acids. There are at least 20 species
of tRNA molecules in every cell, at least one (and often
several) corresponding to each of the 20 amino acids re-
quired for protein synthesis. Although each specific
tRNA differs from the others in its sequence of nu-
cleotides, the tRNA molecules as a class have many fea-
tures in common. The primary structure—ie, the nu-
cleotide sequence—of all tRNA molecules allows
extensive folding and intrastrand complementarity to
generate a secondary structure that appears like a
cloverleaf (Figure 35–11).
All tRNA molecules contain four main arms. The
acceptor armterminates in the nucleotides CpCpA
OH
.
These three nucleotides are added posttranscription-
ally. The tRNA-appropriate amino acid is attached to
the 3′-
OH
group of the A moiety of the acceptor arm.
The D, TC, and extra armshelp define a specific
tRNA.
Although tRNAs are quite stable in prokaryotes, they
are somewhat less stable in eukaryotes. The opposite is
true for mRNAs, which are quite unstable in prokary-
otes but generally stable in eukaryotic organisms.
C. R
IBOSOMAL
RNA (
R
RNA)
A ribosome is a cytoplasmic nucleoprotein structure
that acts as the machinery for the synthesis of proteins
from the mRNA templates. On the ribosomes, the
mRNA and tRNA molecules interact to translate into a
specific protein molecule information transcribed from
the gene. In active protein synthesis, many ribosomes
are associated with an mRNA molecule in an assembly
called the polysome.
The components of the mammalian ribosome,
which has a molecular weight of about 4.2 ×106and a
sedimentation velocity of 80S (Svedberg units), are
shown in Table 35–2. The mammalian ribosome con-
tains two major nucleoprotein subunits—a larger one
with a molecular weight of 2.8 × 10(60S) and a
smaller subunit with a molecular weight of 1.4 ×106
(40S). The 60S subunit contains a 5S ribosomal RNA
(rRNA), a 5.8S rRNA, and a 28S rRNA; there are also
probably more than 50 specific polypeptides. The 40S
subunit is smaller and contains a single 18S rRNA and
approximately 30 distinct polypeptide chains. All of the
ribosomal RNA molecules except the 5S rRNA are
processed from a single 45S precursor RNA molecule in
the nucleolus (Chapter 37). 5S rRNA is independently
transcribed. The highly methylated ribosomal RNA
molecules are packaged in the nucleolus with the spe-
cific ribosomal proteins. In the cytoplasm, the ribo-
somes remain quite stable and capable of many transla-
tion cycles. The functions of the ribosomal RNA
molecules in the ribosomal particle are not fully under-
stood, but they are necessary for ribosomal assembly
and seem to play key roles in the binding of mRNA to
Documents you may be interested
Documents you may be interested