itextsharp pdf to image c# : Add photo to pdf form SDK software service wpf winforms .net dnn bioinf-py-23-part1746

def create_protein_fixed(mrna, genetic_code):
protein_fixed = ’’
trans_start_pos = mrna.find(’AUG’)
for i in range(len(mrna[trans_start_pos:])/3):
start = trans_start_pos + i*3
end = start + 3
amino = genetic_code[mrna[start:end]]
if amino == ’X’:
break
protein_fixed += amino
return protein_fixed
protein = create_protein_fixed(mrna, genetic_code)
tofile_with_line_sep_v2(protein, ’output’,
’lactase_protein_fixed.txt’, 70)
print ’10 last amino acids of the correct lactase protein: ’, \
protein[-10:]
print ’Lenght of the correct protein: ’, len(protein)
The output, needed below for comparison, becomes
10 last amino acids of the correct lactase protein: QQELSPVSSF
Lenght of the correct protein: 1927
1.9 Some Humans Can Drink Milk, While Others Cannot
One type of lactose intolerance is called Congenital lactase deficiency. This
is a rare genetic disorder that causes lactose intolerance from birth, and is
particularly common in Finland. The disease is caused by a mutation of the
base in position 30049 (0-based) of the lactase gene, a mutation from T to A.
Our goal is to check what happens to the protein if this base is mutated. This is
asimple task using the previously developed tools:
def congential_lactase_deficiency(
lactase_gene,
genetic_code,
lactase_exon_regions,
output_folder=os.curdir,
mrna_file=None,
protein_file=None):
pos = 30049
mutated_gene = lactase_gene[:pos] + ’A’ + lactase_gene[pos+1:]
mutated_mrna = create_mRNA(mutated_gene, lactase_exon_regions)
if mrna_file is not None:
tofile_with_line_sep_v2(
mutated_mrna, output_folder, mrna_file)
mutated_protein = create_protein_fixed(
mutated_mrna, genetic_code)
if protein_file:
tofile_with_line_sep_v2(
mutated_protein, output_folder, protein_file)
31
Add photo to pdf form - C# PDF Field Edit Library: insert, delete, update pdf form field in C#.net, ASP.NET, MVC, Ajax, WPF
Online C# Tutorial to Insert, Delete and Update Fields in PDF Document
convert word document to editable pdf form; convert word to editable pdf form
Add photo to pdf form - VB.NET PDF Field Edit library: insert, delete, update pdf form field in vb.net, ASP.NET, MVC, Ajax, WPF
How to Insert, Delete and Update Fields in PDF Document with VB.NET Demo Code
cannot edit pdf form; change font size pdf fillable form
return mutated_protein
mutated_protein = congential_lactase_deficiency(
lactase_gene, genetic_code, lactase_exon_regions,
output_folder=’output’,
mrna_file=’mutated_lactase_mrna.txt’,
protein_file=’mutated_lactase_protein.txt’)
print ’10 last amino acids of the mutated lactase protein:’, \
mutated_protein[-10:]
print ’Lenght of the mutated lactase protein:’, \
len(mutated_protein)
The output, to be compared with the non-mutated gene above, is now
10 last amino acids of the mutated lactase protein: GFIWSAASAA
Lenght of the mutated lactase protein: 1389
As we can see, the translation stops prematurely, creating a much smaller protein,
which will not have the required characteristics of the lactase protein.
Acouple of mutations in a region for LCT located in front of LCT (actually
in the introns of another gene) is the reason for the common lactose intolerance.
That is, the one that sets in for adults only. These mutations control the
expression of the LCT gene, i.e., whether that the gene is turned on or off.
Interestingly, different mutations have evolved in different regions of the world,
e.g., Africa and Northern Europe. This is an example of convergent evolution:
the acquisition of the same biological trait in unrelated lineages. The prevalence
of lactose intolerance varies widely, from around 5% in northern Europe, to close
to 100% in south-east Asia.
The functions analyzingthelactase gene are found in the filegenes2proteins.
py
15
.
1.10 Random Mutations of Genes
ASimple Mutation Model. Mutationofgenesiseasilymodeledbyreplacing
the letter in a randomly chosen position of the DNA by a randomly chosen
letter from the alphabet A, C, G, and T. Python’srandom module can be used
to generate random numbers. Selecting a random position means generating
arandom index in the DNA string, and the functionrandom.randint(a, b)
generates random integers between a and b (both included). Generating a
random letter is easiest done by having a list of the actual letters and using
random.choice(list)topickanarbitraryelementfrom list. Afunctionfor
replacing the letter in a randomly selected position (index) by a random letter
among A, C, G, and T is most straightforwardly implemented by converting the
DNA string to a list of letters, since changing a character in a Python string is
impossible without constructing a new string. However, an element in a list can
be changed in-place:
15http://tinyurl.com/q4qpjbt/genes2proteins.py
32
C# PDF insert image Library: insert images into PDF in C#.net, ASP
Insert images into PDF form field. Access to freeware download and online C#.NET class source code. How to insert and add image, picture, digital photo, scanned
create pdf form; pdf forms save
VB.NET PDF insert image library: insert images into PDF in vb.net
Import graphic picture, digital photo, signature and logo into PDF Add images to any selected PDF page in VB.NET. Insert images into PDF form field in VB.NET.
add submit button to pdf form; add attachment to pdf form
import random
def mutate_v1(dna):
dna_list = list(dna)
mutation_site = random.randint(0, len(dna_list) - 1)
dna_list[mutation_site] = random.choice(list(’ATCG’))
return ’’.join(dna_list)
Usingget_base_frequencies_v2 andformat_frequencies from Section 1.7,
we can easily mutate a gene a number of times and see how the frequencies of
the bases A, C, G, and T change:
dna = ’ACGGAGATTTCGGTATGCAT’
print ’Starting DNA:’, dna
print format_frequencies(get_base_frequencies_v2(dna))
nmutations = 10000
for i in range(nmutations):
dna = mutate_v1(dna)
print ’DNA after %d mutations:’ % nmutations, dna
print format_frequencies(get_base_frequencies_v2(dna))
Here is the output from a run:
Starting DNA: ACGGAGATTTCGGTATGCAT
A: 0.25, C: 0.15, T: 0.30, G: 0.30
DNA after 10000 mutations: AACCAATCCGACGAGGAGTG
A: 0.35, C: 0.25, T: 0.10, G: 0.30
Vectorized Version. Theefficiencyofthemutate_v1functionwithitssur-
rounding loop can be significantly increased up by performing all the mutations
at once usingnumpy arrays. This speed-up is of interest for longdna strings
and many mutations. The idea is to draw all the mutation sites at once, and
also all the new bases at these sites at once. Thenp.random module provides
functions for drawing several random numbers at a time, but only integers and
real numbers can be drawn, not characters from the alphabet A, C, G, and T.
We therefore have to simulate these four characters by the numbers (say) 0, 1,
2, and 3. Afterwards we can translate the integers to letters by some clever
vectorized indexing.
DrawingN mutation sites is a matter of drawingN random integers among
the legal indices:
import numpy as np
mutation_sites = np.random.random_integers(0, len(dna)-1, size=N)
Drawing N bases, represented as the integers 0-3, is similarly done by
new_bases_i = np.random.random_integers(0, 3, N)
Converting say the integers 1 to the base symbol C is done by picking out the
indices (in a boolean array) wherenew_bases_i equals 1, and inserting the
character ’C’ in a companion array of characters:
33
VB.NET Image: Mark Photo, Image & Document with Polygon Annotation
on PDF file without using external PDF editing software. VB.NET Methods to Add Polygon Annotation. In this Public Partial Class Form1 Inherits Form Public Sub
create a fillable pdf form from a word document; change font size in pdf fillable form
VB.NET Image: Image Cropping SDK to Cut Out Image, Picture and
VB.NET image cropping method to crop picture / photo; size of created cropped image file, add antique effect Public Partial Class Form1 Inherits Form Public Sub
changing font size in pdf form; adding signature to pdf form
new_bases_c = np.zeros(N, dtype=’c’)
indices = new_bases_i == 1
new_bases_c[indices] = ’C’
We must do this integer-to-letter conversion for all four integers/letters. There-
after,new_bases_c must be inserted indna for all the indices corresponding to
the randomly drawn mutation sites,
dna[mutation_sites] = new_bases_c
The final step is to convert thenumpy array of charactersdna back to a stan-
dard string by first convertingdna to a list and then joining the list elements:
”.join(dna.tolist()).
The complete vectorized functions can now be expressed as follows:
import numpy as np
# Use integers in random numpy arrays and map these
# to characters according to
i2c = {0: ’A’, 1: ’C’, 2: ’G’, 3: ’T’}
def mutate_v2(dna, N):
dna = np.array(dna, dtype=’c’) # array of characters
mutation_sites = np.random.random_integers(
0, len(dna) - 1, size=N)
# Must draw bases as integers
new_bases_i = np.random.random_integers(0, 3, size=N)
# Translate integers to characters
new_bases_c = np.zeros(N, dtype=’c’)
for i in i2c:
new_bases_c[new_bases_i == i] = i2c[i]
dna[mutation_sites] = new_bases_c
return ’’.join(dna.tolist())
It is of interest to timemutate_v2 versusmutate_v1. For this purpose we
need a long test string. A straightforward generation of random letters is
def generate_string_v1(N, alphabet=’ACGT’):
return ’’.join([random.choice(alphabet) for i in xrange(N)])
A vectorized version of this function can also be made, using the ideas
explored above for the mutate_v2 function:
def generate_string_v2(N, alphabet=’ACGT’):
# Draw random integers 0,1,2,3 to represent bases
dna_i = np.random.random_integers(0, 3, N)
# Translate integers to characters
dna = np.zeros(N, dtype=’c’)
for i in i2c:
dna[dna_i == i] = i2c[i]
return ’’.join(dna.tolist())
Thetime_mutate function in the filemutate.py16 performs timing of the
generation of test strings and the mutations. To generate a DNA string of length
16
http://tinyurl.com/q4qpjbt/mutate.py
34
VB.NET Image: Image Scaling SDK to Scale Picture / Photo
about this VB.NET image scaling control add-on, we RE__Test Public Partial Class Form1 Inherits Form Public Sub can only scale one image / picture / photo at a
change tab order in pdf form; adding an image to a pdf form
VB.NET Image: Image Resizer Control SDK to Resize Picture & Photo
VB.NET Image & Photo Resizing Overview. The practical this VB.NET image resizer control add-on, can powerful & profession imaging controls, PDF document, image
can reader edit pdf forms; pdf form change font size
100,000 the vectorized function is about 8 times faster. When performing 10,000
mutations on this string, the vectorized version is almost 3000 times faster!
These numbers stay approximately the same also for larger strings and more
mutations. Hence, this case study on vectorization is a striking example on
the fact that a straightforward and convenient function likemutate_v1 might
occasionally be very slow for large-scale computations.
AMarkov Chain Mutation Model. Theobservedrateatwhichmutations
occur at agiven position in the genomeis not independent of the typeof nucleotide
(base) at that position, as was assumed in the previous simple mutation model.
We should therefore take into account that the rate of transition depends on the
base.
There are a number of reasons why the observed mutation rates vary between
different nucleotides. One reason is that there aredifferent mechanisms generating
transitions from one base to another. Another reason is that there are extensive
repair process in living cells, and the efficiency of this repair mechanism varies
for different nucleotides.
Mutation of nucleotides may be modeled using distinct probabilities for
the transitions from each nucleotide to every other nucleotide. For example,
the probability of replacing A by C may be prescribed as (say) 0.2. In total
we need 4× 4 probabilities since each nucleotide can transform into itself (no
change) or three others. The sum of all four transition probabilities for a given
nucleotide must sum up to one. Such statistical evolution, based on probabilities
for transitioning from one state to another, is known as a Markov process or
Markov chain.
First we need to set up the probability matrix, i.e., the 4× 4 table of
probabilities where each row corresponds to the transition of A, C, G, or T into
A, C, G, or T. Say the probability transition from A to A is 0.2, from A to C is
0.1, from A to G is 0.3, and from A to T is 0.4.
Rather than just prescribing some arbitrary transition probabilities for test
purposes, we can use random numbers for these probabilities. To this end, we
generate three random numbers to divide the interval [0,1] into four intervals
corresponding to the four possible transitions. The lengths of the intervals give
the transition probabilities, and their sum is ensured to be 1. The interval limits,
0, 1, and three random numbers must be sorted in ascending order to form the
intervals. We use the functionrandom.random() to generate random numbers
in [0,1):
slice_points = sorted(
[0] + [random.random() for i in range(3)] + [1])
transition_probabilities = [slice_points[i+1] - slice_points[i]
for i in range(4)]
The transition probabilities are handy to have available as a dictionary:
35
VB.NET Image: How to Save Image & Print Image Using VB.NET
of saving and printing multi-page document files, like PDF and Word printing assembly with VB.NET web image viewer add-on, you VB.NET Code to Save Image / Photo.
add jpg to pdf form; add editable fields to pdf
C# Image: How to Add Antique & Vintage Effect to Image, Photo
this C#.NET antique effect creating control add-on is widely used in modern photo editors, which powerful & profession imaging controls, PDF document, tiff
chrome pdf save form data; pdf add signature field
markov_chain[’A’] = {’A’: ..., ’C’: ..., ’G’: ..., ’T’: ...}
which can be computed by
markov_chain[’A’] = {base: p for base, p in
zip(’ACGT’, transition_probabilities)}
To select a transition, we need to draw a random letter (A, C, G, or T)
according to the probabilities markov_chain[b] where b is the base at the
current position. Actually, this is a very common operation, namely drawing a
random value from a discrete probability distribution (markov_chain[b]). The
natural approach is therefore write a general function for drawing from any
discrete probability distribution given as a dictionary:
def draw(discrete_probdist):
"""
Draw random value from discrete probability distribution
represented as a dict: P(x=value) = discrete_probdist[value].
"""
# Method:
# http://en.wikipedia.org/wiki/Pseudo-random_number_sampling
limit = 0
r = random.random()
for value in discrete_probdist:
limit += discrete_probdist[value]
if r < limit:
return value
Basically, the algorithm divides [0,1] into intervals of lengths equal to the
probabilities of the various outcomes and checks which interval is hit by a random
variable in [0,1]. The corresponding value is the random choice.
Acomplete function creating all the transition probabilities and storing them
in a dictionary of dictionaries takes the form
def create_markov_chain():
markov_chain = {}
for from_base in ’ATGC’:
# Generate random transition probabilities by dividing
# [0,1] into four intervals of random length
slice_points = sorted(
[0] + [random.random()for i in range(3)] + [1])
transition_probabilities = \
[slice_points[i+1] - slice_points[i] for i in range(4)]
markov_chain[from_base] = {base: p for base, p
in zip(’ATGC’, transition_probabilities)}
return markov_chain
mc = create_markov_chain()
print mc
print mc[’A’][’T’] # probability of transition from A to T
It is natural to develop a function for checking that the generated probabilities
are consistent. The transition from a particular base into one of the four bases
36
VB.NET Image: Tutorial for Flipping Image Using Our .NET Image SDK
version of .NET imaging SDK and add the following becomes a mirror reflection of the photo on the powerful & profession imaging controls, PDF document, tiff
change font pdf fillable form; can reader edit pdf forms
C# PDF remove image library: remove, delete images from PDF in C#.
Highlight Text. Add Text. Add Text Box. Drawing vector image, graphic picture, digital photo, scanned signature and remove multiple or all images from PDF document
create a fillable pdf form from a pdf; change tab order in pdf form
happens with probability 1, which means that the probabilities in a row must
sum up to 1:
def check_transition_probabilities(markov_chain):
for from_base in ’ATGC’:
s = sum(markov_chain[from_base][to_base]
for to_base in ’ATGC’)
if abs(s - 1) > 1E-15:
raise ValueError(’Wrong sum: %s for "%s"’ % \
(s, from_base))
Another test is tocheck thatdraw actually draws random values in accordance
with the underlying probabilities. To this end, we draw a large number of values,
N, countthefrequenciesof thevariousvalues,divideby Nandcompare the
empirical normalized frequencies with the probabilities:
def check_draw_approx(discrete_probdist, N=1000000):
"""
See if draw results in frequencies approx equal to
the probability distribution.
"""
frequencies = {value: 0 for value in discrete_probdist}
for i in range(N):
value = draw(discrete_probdist)
frequencies[value] += 1
for value in frequencies:
frequencies[value] /= float(N)
print ’, ’.join([’%s: %.4f (exact %.4f)’ % \
(v, frequencies[v], discrete_probdist[v])
for v in frequencies])
This test is only approximate, but does bring evidence to the correctness of the
implementation of the draw function.
Avectorized version ofdraw can also be made. We refer to the source code
file mutate.py
17
for details (the function is relatively complicated).
Now we have all the tools needed to run the Markov chain of transitions for
arandomly selected position in a DNA sequence:
def mutate_via_markov_chain(dna, markov_chain):
dna_list = list(dna)
mutation_site = random.randint(0, len(dna_list) - 1)
from_base = dna[mutation_site]
to_base = draw(markov_chain[from_base])
dna_list[mutation_site] = to_base
return ’’.join(dna_list)
Exercise 6 suggests some efficiency enhancements of simulating mutations via
these functions.
Here is a simulation of mutations using the method based on Markov chains:
17
http://tinyurl.com/q4qpjbt/mutate.py
37
dna = ’TTACGGAGATTTCGGTATGCAT’
print ’Starting DNA:’, dna
print format_frequencies(get_base_frequencies_v2(dna))
mc = create_markov_chain()
import pprint
print ’Transition probabilities:\n’, pprint.pformat(mc)
nmutations = 10000
for i in range(nmutations):
dna = mutate_via_markov_chain(dna, mc)
print ’DNA after %d mutations (Markov chain):’ % nmutations, dna
print format_frequencies(get_base_frequencies_v2(dna))
The output will differ each time the program is run unlessrandom.seed(i)
is called in the beginning of the program for some integeri. This call makes
the sequence of random numbers the same every time the program is run and is
very useful for debugging. An example on the output may look like
Starting DNA: TTACGGAGATTTCGGTATGCAT
A: 0.23, C: 0.14, T: 0.36, G: 0.27
Transition probabilities:
{’A’: {’A’: 0.4288890546751146,
’C’: 0.4219086988655296,
’G’: 0.00668870644455688,
’T’: 0.14251354001479888},
’C’: {’A’: 0.24999667668640035,
’C’: 0.04718309085408834,
’G’: 0.6250440975238185,
’T’: 0.0777761349356928},
’G’: {’A’: 0.16022955651881965,
’C’: 0.34652746609882423,
’G’: 0.1328031742612512,
’T’: 0.3604398031211049},
’T’: {’A’: 0.20609823213950174,
’C’: 0.17641112746655452,
’G’: 0.010267621176125452,
’T’: 0.6072230192178183}}
DNA after 10000 mutations (Markov chain): GGTTTAAGTCAGCTATGATTCT
A: 0.23, C: 0.14, T: 0.41, G: 0.23
Note that the mutated DNA should contain more nucleotides of the type where
the total probability of transitioning into that particular nucleotide is largest.
The total probability of transitioning into a particular base can be computed by
abit a probability algebra. LetX be the initial base at some position in the
DNA and letY be the new base after mutation at this position. The probability
thatP(Y =b), whereb is some base (A, C, G, or T), is built up of four mutually
exclusive events:
P(Y = b) = P(X = A∪Y = b)+P(X = C∪Y = b)+P(X = G∪Y = b)+P(X = T∪Y = b)
Ajoint event can be expressed by the (conditional) transition probabilities, e.g.,
P(X = A ∪ Y = b) = P(Y = b|X = A)P(X = A)
leading to
P(Y = b) =
i∈{A,C,G,T}
P(Y = b|X = i)P(X = i)
38
The probabilitiesP(Y =b|X =i) correspond to a column in the transition
probability matrix. If each of the initial eventsP(X =i) are equally probable,
P(= i)=1/4,and P(= b)isthenthe sumof theprobabilitiesinthe
column corresponding tob, divided by 4. We can now computeP(Y =b) forb
as A, C, G, and T:
def transition_into_bases(markov_chain):
return {to_base: sum(markov_chain[from_base][to_base]
for from_base in ’ATGC’)/4.0
for to_base in ’ATGC’}
print transition_into_bases(mc)
The P(X = b) probabilities corresponding to the example run above reads
{’A’: 0.26, ’C’: 0.25, ’T’: 0.30, ’G’: 0.19}
Transition into T (P(Y =T)) has greatest probability (0.3) and this is also
confirmed by the greatest frequency (0.41).
The various functions performing mutations are located in the filemutate.
py
18
.
2 Classes for DNA Analysis
We shall here exemplify the use of classes for performing DNA analysis as
explained in the previous text. Basically, we create a classGene to represent a
DNA sequence (string) and a classRegion to represent a subsequence (substring),
typically an exon or intron.
2.1 Class for Regions
The class for representing a region of a DNA string is quite simple:
class Region:
def __init__(self, dna, start, end):
self._region = dna[start:end]
def get_region(self):
return self._region
def __len__(self):
return len(self._region)
def __eq__(self, other):
"""Check if two Region instances are equal."""
return self._region == other._region
def __add__(self, other):
"""Add Region instances: self + other"""
return self._region + other._region
18
http://tinyurl.com/q4qpjbt/mutate.py
39
def __iadd__(self, other):
"""Increment Region instance: self += other"""
self._region += other._region
return self
Besides storing the substring and giving access to it throughget_region, we
have also included the possibility to
• say len(r) if r is a Region instance
• check if two Region instances are equal
• write r1 + r2 for two instances r1 and r2 of type Region
• perform r1 += r2
The latter two operations are convenient for making one large string out of all
exon or intron regions.
2.2 Class for Genes
The class for gene will be longer and more complex than classRegion. We
already have a bunch of functions performing various types of analysis. The idea
of theGene class is that these functions are methods in the class operating on
the DNA string and the exon regions stored in the class. Rather than recoding
all the functions as methods in the class we shall just let the class “wrap” the
functions. That is, the class methods call up the functions we already have.
This approach has two advantages: users can either choose the function-based
or the class-based interface, and the programmer can reuse all the ready-made
functions when implementing the class-based interface.
The selection of functions include
• generate_string for generating a random string from some alphabet
• downloadand read_dnafile(version read_dnafile_v1)fordownloading
data from the Internet and reading from file
• read_exon_regions (version read_exon_regions_v2)forreadingexon
regions from file
• tofile_with_line_sep(version tofile_with_line_sep_v2)forwriting
strings to file
• read_genetic_code(version read_genetic_code_v2)forloadingthemap-
ping from triplet codes to 1-letter symbols for amino acids
• get_base_frequencies(version get_base_frequencies_v2)forfinding
frequencies of each base
• format_frequencies for formatting base frequencies with two decimals
40
Documents you may be interested
Documents you may be interested